AN EASY 16S EXERCISE


EXPERIMENT 14b
TITLE
Identification of compounds by nucleotide sequence analysis obtained from 16s rRNA sequence
SUMMARY
A nucleotide sequence is provided to students to BLAST with NCBI database (or other) and identify.  The matching percentage and origin of the sequence is discussed based on statistics provided from the BLAST. 

http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome 

RESULTS
Sequence #18
GTTCTTTCGGTATTGAGGAAGGTTGATGTGTTAATAGCACATCAAATTGACGTTAAATACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGNGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGNATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGAAGGCGAAGGCAGCCCCTTGGGAATGTACTGACGCTCATGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGCTGTCGATTTGGGGGTTGGGGTTTAACTCTGGCACCCGT


Figure 14b.1: NCBI BLAST alignment score for unknown nucleotide sequence 18

Figure 14b.2: NCBI BLAST top match for unknown nucleotide sequence 18; Haemophilus influenzae strain 680 16S ribosomal RNA gene, complete sequence

RESULT SUMMARY

There are no gaps.  The E score is 0.  Sequence is a 100% match to 16S rRNA of Haemophilus influenzae.


DISCUSSION
An unknown nucleotide sequence is provided to students to identify.  The sequence was analyzed using NCBI BLAST and was a 100% match to 16S rRNA of Haemophilus influenzae.  16S is the small ribosomal subunit of the 30S ribosome subunit.  This section of the ribosome is highly conserved among prokaryotes and can be used to identify bacteria species by amount of mutations.  As bacteria diverged, more mutations in the 16S occurred and created differences between bacteria that can be amplified and sequenced. 
Because the identification is based on mutations as species diverged, more recently divergent bacteria cannot be confidently identified.[1]  A high percentage identity is an indicator of a good match.  In this case, there is a 100% match to Haemophilus influenzae
Identity is related to gap percentage.  A gap in an alignment can be from a no-call (N) in the sequence.  If a sequence is returned with an N, it can be manually changed based on the chromatogram reading and BLASTed.  Another reason there may be a gap is from a different nucleotide.  A different nucleotide may come from an error, a SNP, or it may be a true difference between the actual sequence and the sequence the database is comparing it to.  The more gaps, the less identity the actual sequence has to the database comparison. The unknown sequence has no gaps when compared to Haemophilus influenzae
            The E value is the expectation of multiple matches to the unknown sequence.  If the gap percentage is high, there is a possibility the match of the sequence to the database comparison is incorrect.  If multiple matches are expected, the E value increases.  If there is a low gap percentage and or a high identity percentage, the E value will be low because there is no expectation to have multiple matches.  One exception to this is if a sequence has a high identity percentage but matches only a partial sequence, there could be multiple partial sequences it matches to in the database.  For this reason, it is better to BLAST longer sequences to get better matches.  As mentioned earlier, a relatively recent divergent species may also have few differences from the species from which it diverged.  A partial sequence may match both species with a high identity percentage and the E value will be higher.  For the unknown sequence analyzed, the returned BLAST result was a complete sequence with a low E value (0.0).  This is an indicator of an acceptable sequence identity.




[1] I happen to know that Campylobacter coli and Campylobacter jejuni are actually converging over time instead of diverging but can’t find a source.  It was mentioned in DISCOVER magazine a few years ago.





MAYBE CRAZY BABY

saturday was for yoga and aerial and watching my library movies.

yoga was crowded!  but it makes class more fun.  i saw four of my friends in class, we had some giggles. ;)  also i was feeling the aster and did the splits today!  woo hoo~ i haven't been stretchy enough to do it in over a month.

in aerial, we are learning a new routine!  in the first half, we already have one flip and one drop.  can't wait to see what else to come... i'll try to snap a pic at this saturday's practice.

the movies i watched (are they indicative of state of mind? haaaaa!):
first, Seven Psychopaths.




Morbid and hillarious! I live Sam Rockwell and Christopher Walken- they play the best crazy people. I especially liked the part about the rabbits. And the story about the flag pole. And I like murderers with calling cards.  This movie only came out last year so I won't say toooo much more... (actually it came out in 2012. i am so slow on the watching.)


The other movie I watched was Moon.  One of my favorite space nervous breakdown movies!



I saw it was back on the shelf at down town library so I picked it up.  Pure coincidence, by the way, I didn't know Sam Rockwell was also in seven psychopaths when I borrowed it. He is awesome in moon, such a range of emotions! I like the story of this movie because I always worry that spending too much time by yourself is bad for your health. I also like GERTY the robot. I guess the same range of emotions CAN be shown with just an array of happy faces, but the lack of vocal emotion is a bit creepy. The whole time I wonder if that bot is up to no good even though I know otherwise.  My favorite part is Sam asking GERTY "am I a clone?" And GERTY responds "are you hungry?" Hahaha! nice to know the robot laws are in full effect.


My cheese presentation went well and i wrote two lab reports, go me!  Just four more reports and one paper to go...






PS-

i sort of need this shirt!  sailor moon FTW!

http://www.lookhuman.com/design/41916-girls-will-save-the-world



JUST READ IT

thanks everyone for the book recommendations, keep them coming! here's some that have peaked my interest:

1) Atlas Shrugged- Ayn Rand
2) Spook- Mary Roach
3) Heart Shaped Box- Joe Hill
4) The Graveyard book- Neil Gaiman
5) Neuromancer- William Gibson
6) Another Roadside Attraction- Tom Robbins
7) Jonathan Strange & Mr Norrel- Susannah Clarke
8) Anathem - Neal Stephenson




So, I did it. I squashed my nerves and went to Samadhi on weds and had a great time!  Nice people. Talented people! I really dont know what i was worried about... yeah, theres a learning curve but everyone was so helpful and patient.  
To get there you actually have to go inside Boca Hawaii and there's a stairwell that leads to the loft.  When I walked in, the guy at the Boca counter was like, "upstairs?". :)  I already had a good feeling about this place if I look like I belong "upstairs". 
And then, upon entering, I see crash mats on the floor and traps and silks hanging from the ceiling and a pile of exercise balls in the corner... I feel like I know what my goal in life is now. What an amazing place! /(* u * )/
And did I get my butt kicked?  Hell yes. (If you think you're pretty strong, try a dozen push ups and then try to straddle up on the trap without looking like a baby! T___T ) but it was a good butt kicking.  I learned a new climb and a variety of other exercises that i plan to do throughout the week.  I also found out I can hula hoop even after not picking one up in over a decade, haha. My arms- I can't lift them today but for some reason I feel happy. I'm so glad I went! 




Stomach sinking, my feet are off the ground, a moment of eternity suspended in the breeze. Until I descend towards the ground, close in, come down and crash straight into your lungs. There’s a chamber of glass that you put in my mind and I find it real hard to control sometimes, but I shallow my breath, I withdraw my tongue. Every gallop leads to a change in pace, every change leads to leap of faith. Give me the strength to face this. Adrenaline, it can be so cruel, can you feel it in your heart it’s defeating you. Every change leads to a leap of faith. My feet are desperately taking these steps that I then retrace, and my blood it raced like stallions.

Workflow for identifying multiple unknown organisms in a clinical sample

A case history is provided with a presumptive vaginal discharge swab in transport media. The patient is a 29-year-old female on birth control presenting vaginal itching and discharge.  The discharge is described as thick, clumpy, white, and odorless.
            Given the patient history, possible pathogens are ones that can cause vaginitis and are possibly STIs; if she is on birth control the patient is most likely sexually active.  While enterobacteriaceae cannot be ruled out, those that cause gastroenteritis are probably not suspect.  A white, clumpy discharge could be due to yeast.
            Upon receiving the sample, the swab was streaked for isolation on to BAP to observe hemolysis patterns and general growth.  BAP is not selective and most organisms can grow on this media.  The plate was stabbed in the first quadrant to enhance hemolysis in semi-anaerobic conditions (under the agar).  The BAP was incubated for 48 hours at 37ºC in a candle jar to enhance growth of fastidious organisms.  A CHOC was also streaked for isolation.  CHOC is more enriching than BAP because red blood cells in the agar are hemolyzed, allowing the bacteria easier access to nutrients.  The CHOC was also incubated at 37ºC in a candle jar for 48 hours.
            On the first day of investigation, the CHOC showed growth in three quadrants of a white, opaque, medium to large organism that Gram stained as gram positive cocci.  The BAP showed two organisms.  A medium to large, white, opaque, beta-hemolytic organism grew in three quadrants.  It Gram stained as a gram positive cocci, presumptively the same as the organism on CHOC.  A second organism was a white, opaque, raised colony with spiky projections that grew in two quadrants.  The Gram stain showed large, gram positive, oval morphology consistent with yeast. 
            The gram positive cocci (GPC) was catalase tested and found to be catalase positive, consistent with Staphylococcus sp.  To speciate the organism, a tube coagulase test was set up and allowed to incubate at 37ºC for 24 hours.  A positive coagulase test would indicate Staphylococcus aureus.  A Novobiocin sensitivity test was set up on the same day to speciate the organism in case the tube coagulase test was negative.  A TSA was streaked for isolation, and a Novobiocin disk was placed in the middle of the first quadrant.  The plate was incubated at 37ºC for 48 hours.  Resistance to NB would indicate Staphylococcus saprophyticus.
            The yeast recovered from the BAP was streaked on to EMB to speciate it.  A pink-light purple growth would indicate Candida albicans.  A dark purple growth would indicate Candida tropicalis.  Other yeasts examined in our lab such as Saccharomyces cerevisiae are rarely pathogens and rarely found as normal flora.  The case history did not indicate the patient is immune compromised or in a living situation where S. cerevisiae would be incorporated in normal flora so its identity was not pursued further. 
            On the second day of investigation the EMB showed light purple growth consistent with ­C. albicans.  This is a reasonable conclusion based on the type of discharge- white and chunky- and because C. albicans is commonly isolated from female humans’ genital tracts.  For many carriers, C. albicans is not a pathogen unless allowed to over colonize the mucus membrane and cause thrush.  This usually happens only in extreme immune compromised patients such as HIV or AIDS patients.  In this case, the C. albicans is probably benign; it is contributing to some of the discharge but not necessarily causing serious vaginitis.  A doctor may or may not prescribe measures to reduce the amount of yeast.
The GPC tests- tube coagulase and NB sensitivity- were examined.  The tube coagulase test was negative indicating the organism is not S. aureus.  The organism was also sensitive to NB indicating it is not S. saprophyticus.  A coagulase Staphylococcus sp. that we worked with previously is Staphylococcus epidermidis.  This organism is a mannitol non-fermenter.  To confirm the identity, a mannitol salt agar (MSA) was streaked with this organism for isolation and incubated at 37ºC for 48 hours.

On the third day of investigation, the MSA plate showed growth in three quadrants of a white, raised, opaque organism that was mannitol non-fermenting.  The fermentation property and halo tolerance of this organism indicates it is S. epidermidis.  S. epidermidis is an opportunistic pathogen, commonly found on skin as normal flora.  Most isolations of S. epidermidis are contaminants, such as improper sanitization of blood culture site but can be the causative pathogen when it forms biofilms on medical devices such as catheters and implants. 
EMB plate.  note light purple-pink colored colonies indicating C. albicans

Zone of inhibition around NB disc on TSA.  This indicates it is not S. saprophyticus (NB resistant).



Gram positive cocci morphology of S. epidermidis


ZONE DE RÊVE

FFFFFFFRIDAY is here again! (already? i know!)
this week i was super stressed as usual but was able to meet all my deadlines (miraculously).  i even had some time to spare (identified my unknowns a week early, say what?!) so i did extra exercises this week (yoga tuesday, samadhi wednesday, then i'll have regular yoga and aerial on saturday) so nice to sweat your stress away.  something amazing about exercising... the adrenaline or endorphines or whatever.  you can't help but feel better afterwards. :_)  did you ever have one of those moments where you are so relieved you just want to cry? (no one else? really? ok, maybe i'm weird, that's alright.)  anyway, that was my week.  the end is near, people!  just a few exams.  and a presentation. and six more lab reports until the end of the semester. *whimper*   but i'm feeling refreshed after exercising and i'm ready to take on the last load of paperwork.  here's the friday5.  origin: http://f.riday5.com/?p=993
  1. Those silly TV programs showcasing supposedly funny videos often feature unexpected blows to someone’s Man Zone (you know, crotch shots). How amusing do you find these videos?

    i feel apathetic?  i mean, i'm not overly excited about watching this but i don't necessarily feel sorry for the guy either, unless it was an unwarranted hit by a kid or an animal.  i'm not a dude so maybe i don't feel as bad for them as i should?  #unrelateableexperience 
  2. Athletes today often talk about being “in the zone,” attaining that state of mind where everything is both automatic and excellent. When did you last find yourself in the zone?

    as you may know, i've passed on my campy work to an awesome person so i have been working on a different research project for the past nine months.  when i used to set up campy invasion assays, i was in the zone.  have all my reagents out and ready, have my timers set up and my box of pipette tips and bleach ready.  and then you just get the multichannel and go!  i tend to talk to myself while i'm doing the plate transfers too, just to prevent parallax, "A1 goes to A1, A1 goes to A2, A1 goes to B1, A1 goes to B2, switch tips, B2 goes to C1, B2 goes to C2, B2 goes to D1... " it was like a mantra. nothing could stop me.  no strange music, no fire alarms, no people walking in and out to use the incubator.  just me and the pipette and the campy filling up the plate.
  3. What time zone do you live in, and is there anything especially good or bad about it?

    IN HAWAII WE DON'T HAVE DAYLIGHT SAVINGS TIME, BITCHES. ♡
  4. Where can you get a really good calzone?

    i don't know! T___T 
    i hope another friday5-er answers this because i LOOOVE PIZZA.
  5. In the Star Trek universe, a neutral zone is an area between claimed territories in space where bordering governments agree not to tread (else war is declared). Where in your personal or professional life are the neutral zones?

    Masa, from the research lab, is very particular.  I try to stay out of his way.  he's a nice guy, just has a particular set up, and i don't know the details of his project and don't want to mess anything up.  he gets upset if people try to use his equipment... i don't think he'd be upset with me but i don't really want to find out.  likewise, he doesn't have any comments on campy stuff so we talk during lab meetings but don't encounter each other much besides that.





A cynical tale of this feeling of calm, told in remorse through the clench of my jaw. I even sung with the birds as they sensed the storm. If the death of chaos is the birth of clarity then bring me to the ground.



NEW AND OLD

= Written on Monday 4/21/14 =


I signed up for a class at Samadhi on Wednesday! I'm nervous excited, I've always wanted to do aerial there but was worried I'm not good enough.  The session I signed up for is an open level conditioning class... So I'm going to get my butt kicked regardless of what apparatus is going on, haha. Lehua recommended it to me so I figured I'd give it a try. If its a good experience I'll definitely consider more classes in the summer (they have trap and Lyra *weeeee*).
One of the mottos i live by is "Nerves are for people who haven't made up their minds yet."  Yes, I am guilty right now, I hope I don't make a fool of myself this week! :S
On Sunday I watched the remake of the movie, Carrie.  It was as awesome as the original.  It stayed true to the original but had some modern updates- cyber bullying.  Translates really well in the story; Stephen King was really ahead of his time when he wrote this. My favorite parts: 
1) the blood drop
2) all the scissors pointing at mom
3) the carsplosion (it wasn't a car flip like the original but it was an equivalent disaster)


When Three Cheers for Sweet Revenge came out (i remember the first time i heard I'm not okay was the day after thanksgiving at 4am on mtv because i couldn't  sleep and wanted some background noise. i was wearing my favorite green shirt and it was also the first time i heard She's the blade by Sugarcult. i think i was in the 9th grade. funny, the things you remember.) I was listening to that album on repeat for days!  So much that I got sick of it and couldn't listen to it again for years.  I don't know what got into me, I knew (know) the lyrics by heart and danced around my room to every song and then one day... I just couldn't stand it anymore. 
A few weeks ago I lent Jojojo all my Weezer CDs (once upon a time I was a =W= fanatic) and saw the overplayed MCR album and decided, why not? It's been years!  Turns out there is still a place in my heart (and iTunes library) for this disc.  I forgot how exciting every song is and the great guitar parts and the story in the lyrics.  Great to listen to at work before morning rounds to get pumped up.



I think I'm going to go through my old CDs and find more albums from the 00s I haven't listened to in a while.  Might find some lost gems. :)


MORE AND MORE

I just finished reading two books.  The nonfiction, Dreamland, which I mentioned a month or two ago, followed by Fishbones, a fiction I bought on kick started because I like the author as an artist.



Dreamland was a fun, easy, interesting, scientific read.  I enjoyed the research that went into it; I enjoyed the articles the author reviewed.  But I didn't learn anything I didn't already know from taking science of sleep class (its PHYL 160 at KCC: https://www.sis.hawaii.edu/uhdad/avail.classes?i=KAP&t=201510&s=PHYL but i took it from herve, not the current instructor.  i also see there is a sleep lab being offered now too?!?!!?!?!!!!), besides the history of sleep and sleep style/furniture.  I was kind of hoping to get more info on sleep walking- not because I do it (I mean, at least I don't think I sleep walk...?) but because the topic fascinates me.  I am going to try some of the things that the author recommends like lowering your body temperature to fall asleep and getting more sun (or simulated sun) light upon waking up.  But sadly, most of the other recommendations are not feasible for people with shifted sleep schedules or people who get <4 hrs if sleep per day on a regular basis. (Typing that sounds so horrible, I am ashamed.). Anyway, I would still recommend this book! It's easy to digest- not too technical but still has the science background that I like.  If you've never studied sleep before, you can learn some basics here about REM and the other stages of the sleep cycle, hormones involved (melatonin/cortisol explained!), and sleep apnea's connection to snoring.  If you already know some if these things, you'll be delighted by the case studies (there is a machine that prevents rats from sleeping, no grad student with a stick required) and the unusual ways sleep study has been useful (dropped murder charges and winning sports competitions).

get this! http://www.amazon.com/Dreamland-Adventures-Strange-Science-Sleep/dp/039308020X
free if you have a library card: http://ipac.librarieshawaii.org/ipac20/ipac.jsp?session=1D980394G1V43.59252&profile=def&uri=link=3100007~!3418910~!3100001~!3100002&aspect=subtab32&menu=search&ri=1&source=~!horizon&term=Dreamland+%3A+adventures+in+the+strange+science+of+sleep+%2F&index=ALLTITL

It took me a while to get through this book because I've been busy reading other science articles and by the time I was finished I was ready to read something crazy and fun.



I was reading on my ipod at the bus stop so I immediately switched to my next book, Fishbones, as soon as I finished dreamland. And I didn't put it down until I was done. Just four days! (I know that's nothing to all you speed readers, but I've been busy and haven't finished a book that fast since Under the Dome first came out;I only had a week since it was on the library Hot Pick list)
As I mentioned before, I got this book from kickstarter and originally heard about it because I've been following the author, as an artist!  Jisuk is one of my favorite artists, I have several of his prints and also his art book.  (And I have a commission from him too but it may or may not be lost on my old hard drive. I'm going to scrounge around for it hopefully i'll find it for this post.  OMG, it still exists!  i was once immortalized by the hand of jisuk! http://jisuk.deviantart.com/art/commission-somnio-insania-121067370 ) I had such a good time with this read because I already knew the characters from his art and from the web comic.  I was thrilled to learn the background and little details of the lives of these characters.  There were a few parts that I normally would have considered too self indulgent, but I was so excited to have my favorite drawings come to life that I didn't mind.  Do you like action? Mafia? Childhood friendships and pop culture? There's a little teenage angst in there too but the snarky dialogue helps it along.  I admit I can't stop gushing about this book, I was really disappointed when I finished it because I didn't want it to end- a great feeling that I haven't had in a long while. And if that's not convincing enough, take a look at this art and tell me you aren't curious about the fantastic story behind it...

http://jisuk.deviantart.com/art/giorgetti-hierarchy-81696269
get the ebook: https://gumroad.com/jisuk
and if you are the type that only reads books with pictures: http://fishbonescomic.com



Summer is soon. I will have my regular job plus another part time job but no homework since I can't take summer school. I want more books!  What should I read?!  Taking suggestions now, please leave your comments. :)





PS- i also take suggestions of movies to watch and albums to listen to!  if it can be found at the library, it will be in my hands... 

Survey of Bacteria Used in Cheese Production

yes, i wrote another paper about cheese.

http://pusheen.tumblr.com 

some music while you read:






Microbes are commonly thought of as dangerous pathogens, especially in the food service industry, however many microbes contribute to the preparation or flavor of popular consumables.  One of these products is cheese.  In 2012, americans consumed more than 33 pounds of cheese per capita (“USDA Economic Research Service - Dairy Data,” n.d.) and its general enjoyment is due to the variety of bacteria that are added in the cheese making process.  Cheese has been produced for hundreds of years in many countries around the world and while modern techniques are being employed in its current production, the key to unique and flavorful cheeses continues to be in the selection and addition of bacteria.  Studying microbiology is important to continued production of excellent cheeses as it helps makers (and consumers) understand the science behind traditional cheese making and how modern biotechnology influences future production and food safety.
The simplest explanation of cheese production is milk solidified by acid.  Milk is an emulsion of proteins, mainly casein, and lipids with a smaller fraction of minerals and other particles.  When acid is added lipid combines with casein to create curds.  Water and lactose leave the solid and is called whey.  The curd is collected and pressed together to form a solid block, which is known as cheese.
            Building upon this process, different types of cheese arise from the different moisture content and flavor, characteristics determined by the method of curdling and ingredients added.  Coagulation techniques used today, not so different from techniques invented decades ago, are in one of three categories- acid coagulated, acid-heat coagulated, and rennet coagulated.  In all three techniques, lactic acid bacteria (LAB) can be added as the acid source.  LAB use lactose in milk for energy and produce lactic acid.  Modulating the temperature, pH and moisture can change the amount of lactic acid produced.  Acid can be added directly to milk, such as in ricotta cheese, but a wider variety of flavors can be achieved by adding bacteria instead; each bacteria has its own flavor profile and a gentle acidification.  Purified lactic acid can also be added to milk to simulate bacterial metabolism but is not cost efficient; it is cheaper to just add bacteria instead of going through the process of purifying lactic acid. 
Once acidified, rennet can be added to improve the texture of the curd.  Rennet causes the casein to aggregate in chains and trap LAB, lipids, and some whey into a matrix.  This results in a more gelatinous texture like in parmesan (uses rennet) compared to crumbly paneer (doesn’t use rennet).  Rennet is a group of enzymes that traditionally come from the stomach of mammals (i.e. cows) and contains protease and lipases.  Rennet can also be of plant or fungal origin.  Called “vegetable rennet”, a popular alternative for animal rennet is produced naturally by fungus Mucor miehei.  With the advent of molecular techniques, a genetically modified fungus, such as the ubiquitous Aspergillus niger is made to ferment components of rennet.  The fermented products will participate in milk coagulation but the organism that produced it will die.  This has led to the FDA approval of this substitute because the actual genetically modified organism is not alive in the final product.  The enzymatically active components of rennet are collectively called chymosin and makes up about 80% of rennet.  Although in cooking chymosin and rennet are often used interchangeably, the wider use of vegetable rennet and fermentation produced chymosin (FPC) is more often called “chymosin”, and only animal produced enzymes are called rennet, because the additional proteins found in animal rennet are not present in plant based enzymes.  Comparing the products, FPC is the most similar to rennet because the transformed organisms had genes originally isolated from mammals.(Salgado et al., 2013)  Both types of chymosin are as popular as rennet because it is easy to obtain in large quantities for a low price and have an appeal to vegan or vegetarian consumers.
Historically, LAB were the accidental addition to unrefrigerated milk that incidentally created cheese.  Over time, recipes were perfected by the isolation of specific LAB to create signature blends and more consistent products.  Regional cheeses take on the flavors of the bacteria of the locale and specific maker and are perpetuated by the back slopping process.  Back slopping is the use of a starter from the last prepared batch or a particularly desirable batch for the next batch.  Although it is not a controlled process, desirable bacteria are more likely to out-compete unwanted bacteria in the next batch.  A more precise and hygienic way to add live cultures to food is to completely characterize bacteria and use specific amounts in the production stages.
Traditionally, bacteria from food samples can be identified and characterized by biochemical tests and use of selective and differential media.  A modern and efficient way alternative to this is 16s ribosomal RNA sequencing.  The 16s ribosomal subunit is found in prokaryotes and is highly conserved.  PCR amplification is used in combination with sequencing to identify bacteria.  The sequence produced from PCR with 16s [universal] primers are compared to sequences in databases such as NCBI BLAST to identify the genus and species. 
Golija cheese is a regional cheese of Serbia (Amarela Terzic-Vidojevic, 2014) that is made in small without starters or back slopping.  Rennet is added to milk and the resulting curd is cut into blocks and stored in brine in sealed containers at ~16ºC (above refrigeration but below room temperature) for several months.  A 16s analysis revealed a variety of LAB from the milk source and curd preparation.  A total of 188 gram positive bacteria were characterized by this molecular method and compared with reference strains and traditional biochemical results to show antimicrobial properties and enzymatic activity.  This research has shown a variable amount of bacteria is present in the cheese depending on the stage of preparation.  The specimen with the largest variety of microbes was a 20-day brined cheese.  The most commonly isolated organism is a well-known dairy industry LAB, Leuconostoc mesenteroides, and was found in most young cheeses.  The bacteria responsible for Golija’s signature texture and flavor are Enterococcus faecium and Enterococcus durans.  Along with Enterococcus faecalis, these organisms are also the most commonly recovered bacteria in European cheeses and dairy products. (Cosentino et al., 2004) Interestingly, E. faecium is also an opportunistic pathogen known to cause infantile meningitis but their antibacterial properties prevent more dangerous pathogens such as Listeria monocytogenes from growing in cheeses.  However, it is still advisable to refrain from eating unpasteurized dairy products to avoid acquiring health problems.  This research is an example of how 16s is an effective way to identify and characterize bacteria and may lend itself to large-scale production using the same types of bacteria. 
Microbes for flavor and texture more prominently recognized in the cheese ripening process.  Ripening, also called maturing, is when cheese acquires its signature pungent flavors.  This process can take weeks to years, depending on the type.  After the curds are pressed, they are transferred to frames called hoops and more of the whey is removed by air and gravity.  The resulting form is then brined with salt and bacteria or fungi are added.  Yeasts use the lactic acid produced by the starter.  This lowers the pH and adds different enzymes to the cheese, allowing secondary bacteria to participate in the ripening process.  (Viljoen et al., 2003)  Cheeses with a “crust” or coating, such as brie are only coated with molds on the outside.  Mold can added to the brining solution or after brining, may be sprayed with yeast.  The yeast begin to ferment the cheese starting at the surface and begins penetrating the main body of the cheese from the outside.  In younger cheeses, the crust may be thin and mild.  In older soft cheeses, the crust may be thicker and more pungent as the yeast is allowed to grow progressively toward the body.  In some cases, the crust yeast makes the cheese body softer instead of more firm like the crust itself.  Cheeses that are harder take longer for the yeast to penetrate so the crust is very thin like in asiago or Parmesan cheese. 
The yeast or bacteria can alternately be added directly to the cheese milk instead of just as crust.  For example, Streptococcus thermophilus, a LAB commonly used in fermented dairy products like yogurt, is incorporated in hard cheeses to improve texture due to its secreted polysaccharides.  Low-fat cheeses can be produced with low fat milk when S. thermophilus is added but will still maintain its traditional texture from bacterial produced exopolysaccharides.  Another famous variety, swiss cheese like Emmenthaler, incorporates the bacterium Propionibacterium freudenreichii subsp. shermanii.  The holes, or “eyes” of the cheese is from the CO2 gas produced in citrate metabolism of the organism.  (Mukdsi et al., 2014)  Eyes in Emmenthaler are incidental, even though their presence is a well known cheese characteristic.  P. freuenrichii is added to cheese mainly for its lipolytic action.  The enzymes produced from lipolysis create pungent and fruity flavors.  The lipolysis takes place early in the cheese making process.  Even in the coagulation process, lipolysis is taking place.  In the ripening process, lipolysis takes place while the bacteria are still alive; since this is an early stage in the ripening, the cheese is still soft enough to be stretched into large gas bubbles.  The bubbles get trapped inside the body instead of released from the cheese because of the tough crust.  pH and temperature can also be used to control bubble size.
Another distinct variety of cheese is blue cheese.  The name is descriptive of the colored veins of Penecillium sp. mold growing throughout the cheese.  Different species of Penecillium are used, depending on the region of Europe the cheese is found in (due to cultural regulations).  The regional bacteria give the cheese distinct flavors.  To achieve the deep penetration of mold, the organism is actually injected into the cheese. (Fernández-salguero, 2004) blue cheese, particularly Roquefort, is an old variety that got contaminated by microorganisms from the environment, a cave.  Today, the process is much more controlled so a consistent flavor can be achieved.  In one characterization study, cheese that was not pierced did not maintain full penetration by the surface mold.  When the Penecillium sp. cannot reach the cheese body, less proteolysis occurs and there is a drastic difference in flavor and scent. 
Incidental molds and bacteria enter the cheese in the ripening process over time.  after brining, many cheeses are left exposed to ambient air in storage or aging rooms.  In modern cheese making facilities, the rooms can be temperature and humidity controlled.  Microbes can even be aerosolized and applied to the cheese.   The environmental conditions influence the metabolic process of the organisms in the cheese.  During this time, other microbes from the environment or from the handler can enter the cheese.  In some cases this is a beneficial addition, such as in the E. faecalis addition to Golija previously mentioned.  In other cases, this is an opportunity for pathogens to infiltrate the cheese.  Staphylococcus aureus is a ubiquitous microbe commonly found in skin.  It is an opportunistic pathogen but is a danger when certain serotypes cause toxins.  Cheese is potentially a healthy environment for S. aureus to grow because of high salt factor, storage temperature, and protein content.  Bacteria in crusts and in the cheese body prevent contamination because other bacteria out-compete the growth of S.aureus.  Cheese is also a good traveling food, compared to milk, because it is preserved and will last longer without spoilage.  Pasteurizing the milk in the initial cheese making process removes raw milk pathogens and the proper brining and ripening methods will prevent pathogenic bacteria from reentering the mixture, creating a safe and delicious food product. 
Cheese is a widely consumed food product whose origins reach back many years.  While the original production of cheeses may have been accidental, modern cheese making is a specific science.  The process uses specific bacteria species to control the outcome of the products.  This combination of new and old techniques yields a great variety of cheeses and perfection to the popular food.  The current direction of microbiology will enhance this process and create even more cheeses than the large variety already available to choose from.  Microbiology is essential to the preservation of the art of cheese making.


[References]

Amarela Terzic-Vidojevic, S.M., 2014. IDENTIFICATION AND CHARACTERIZATION OF LACTIC ACID BACTERIA ISOLATED FROM ARTISANAL WHITE BRINED GOLIJA COWS’ MILK CHEESES. Arch. Biol. Sci. 66, 179–192. doi:10.2298/ABS1401179T

Cosentino, S., Pisano, M.B., Corda, A., Fadda, M.E., Piras, C., 2004. Genotypic and technological characterization of enterococci isolated from artisanal Fiore Sardo cheese. J. Dairy Res. 71, 444–450. doi:10.1017/S002202990400041X

Fernández-salguero, J., 2004. Internal Mould - Ripened Cheeses: Characteristics, Composition and Proteolysis of the Main European Blue Vein Varieties. FORMAGGI Matur. CON MUFFE INTERNECARATTERISTICHE Compos. E PROTEOLISI DELLE PIÙ IMPORTANTI Var. Eur. VENATURA BLU 16, 437–445.

Kindstedt, P.S., 2013. The Making of Great Cheeses. Microbe 361–367.

Kindstedt, P.S., 2013. Making Great Cheeses, Part 2. Microbe 401–407.

Mukdsi, M.C.A., Falentin, H., Maillard, M.-B., Chuat, V., Medina, R.B., Parayre, S., Thierry, A., 2014. The Secreted Esterase of Propionibacterium freudenreichii Has a Major Role in Cheese Lipolysis. Appl. Environ. Microbiol. 80, 751–756. doi:10.1128/AEM.03640-13

Pearson, H., 2003. Sequencing reveals secrets of Stilton. Nature News. doi:10.1038/news030609-18

Salgado, J.A.G., Kangwa, M., Fernandez-Lahore, M., 2013. Cloning and expression of an active aspartic proteinase from Mucor circinelloides in Pichia pastoris. BMC Microbiol. 13, 250. doi:10.1186/1471-2180-13-250

USDA Economic Research Service - Dairy Data [WWW Document], n.d. URL http://www.ers.usda.gov/data-products/dairy-data.aspx#.UqYnpbOhAy4 (accessed 12.9.13).


Viljoen, B.C., Khoury, A.R., Hattingh, A., 2003. Seasonal diversity of yeasts associated with white-surface mould-ripened cheeses. Food Res. Int. 36, 275–283. doi:10.1016/S0963-9969(02)00169-2

INSTANT TIME MACHINE!

CERCA TROVA:

TAG MANIA

music Aerial hawaii friday5 yoga samadhi bikeventure school book concert lists science poweryoga hawaii bicycle food la dispute live show microbiology movie movies spring break spring break 2015 vinyl 2010 Book review cardistry cooking phantogram reads rooster teeth silversun pickups work EmM Stephen king beach books coffee destiny metric pyhiflygirls shopping touché amoré virology b9 bacteria bus clothes comics deafheaven drug church interpol mlt movie review roman literature socks vales 6131 YYY amyz art balance and composure batman blood blood bank catullus ceremony cheese coffeesundays cover dengue earl grey exercise gymnastic linguist koji memories mlt adventures molecular motion city soundtrack needle work nightwing no sleep records octopus other realms pacific rim raveonettes recipe republik review saga sspu summer sunbather taking back sunday tattoo tiny cats tycho wiwt yummiestars #hrf2015 2014 accident adult swim singles aerial problems album review anakin anamanaguchi angels and airwaves asm beer best of blast bruises cadence caitlin doughty campy cards carnavas carpe noctem checklist manifesto chemistry chinese christmas culture abuse dc comics deathwish descendents descender dress fight club fishing glow flow goodtime boys grouplove handstand heart shaped box hematology hip key how to with joel and adam hungry ear hurricane interstellar joe hill lab last look lily allen live lucky hell lululemon makeup manoa megwin melissa mr mercedes nails ncbi nerves never come undone orange bang poetry pool ps4 research rohnert park rtpodcast sandwich scattegories sephora sequencing shameless shave ice sick sirens sleep society of s star wars stereochemistry strava sviib sysmex the donnas the modern waikiki the winter passing third man records thrice tissu tove lo training for aerial on the ground waiola weezer xcm yeah yeah yeahs #hrf2016 #myhour #tdf2015 '68 007 100% 11-22-63 16s 1970s 1999 2011 2015 35mm 3hive 7seconds :) @8_semesters @wild_twinkies Carrie Fishbones Godzilla Groundhog Day HST L-cuts L4D2 MCR Pink vans RIP SEM Streptococcus UH a favor house atlantic a girl walks home alone at night abraham lincoln vampire hunter aculpture aesop rock afi agar aji fry alam alfa beach american hustle antics arcade fire art of play atlas genius atul gawande autoclave b sides backstage bai san bakasana baking bandcamp battlewagon bayonetta beach house beach slang beastie boys beats begiragons big grams bike biochem biomusicology birds in a row bitter clarity uncommon grace black dress blaisdell blink 182 bond boscia brad meltzer brambles brazil brew bridge 9 bro force broke for free bronchial wash burrito buxom buy local calzone campy group campylobacter cancer candida candida albicans candy hearts carrot carrot cake cascade casket lottery catbird cdc cheap monday chet faker chinese new year chirashi chloe cho dang chores chozo cinerama circuits circulus cisco kid clarity clones of the queen cloning cls coexist coffee stout coheed and cambria coli com truise comicon common reactor concussion conference constantine contortion cotq cremation crow csf cursive dads daiei dan and dave daniel dae kim dashboard david rees day by day records dead weather deadlines dealersgrip death deep blue delerium detective dee devart dhm diamond youth dick grayson dinosaur pile up disco discordia discount dance discovery distance/closure divination diy dl dna dntel does it work don quijote donnie darko doodles double ankle hang down the cliff dragonette dreams dscvry dustin nguyen e. coli earth wind and fire ebola edge edward benz 27 times el pintor el-p electricity elle king emb emily haines enbalming enjoy your burrito epidemiology eqs esr evenings event evil needle exam exotica fall behind me family fashion fat bob fatale fck felix cartal fiction firefly fitz and the tantrums flash flash fact fletcher c johnson flight facilities flight of the conchords forever 21 forgettable formula x fountains of wayne frameworks franz ferdinand fresh cafe friday the 13th fuck yes fulton funeral game of thrones gate gatsby genetics ghost bc ghost feet ghost key ghostly giant glass good charlotte gpc grant imahara grayson green river gtd guardians of the galaxy guest blogger gym class heroes habits haemophilus influenzae haim halloween handwriting harlem harrow heavy circles helena bertinelli hello hellogoodbye hematocrit heroquest high water marks history channel holiday mart homework houdini howl howl gaff gaff hummus hxc i love crazy tags iasip ice cream identity crisis in all dishonesty in and out of control in gratitude instagram instax interpro into the wayside intrepidity ipod iwant iyo udon jack johnson jack white japan jaspas jejuni jellys jimmy fallon jisuk jjak jld jock john wick joy departed joy division jpb julian casablancas justice league justice league dark kaimana kakaako kapiolani kat von d kegg keratin kimchi kimchijeon kingsman kitsune kittygeddon klaxons koolau ballroom korean koundinyasana lab report latte art lazaretto le castle vania leahi left 4 dead 2 leotard leptospirosis les savy fav let me in lgc library light we made like like drive in lil gothams liquid nitrogen lismore lit little richard llea lol lolita loma prieta longboard lookbook love luster luck lust lust lust lymbyc systym lyra magic magic island magnolia cafe mah jong maiden heist mail day mais2 major league makapuu maldi-tof martin denny martin solveig marvel matty matheson mavica me earl and the dying girl me first and the gimme gimmes media memento memento bento meta metamorphoses mf doom michael crichton micr490L milk tea mind of a chef miss manners mls adventures modern baseball modest mouse mogwai mohawk monuments men moon moose blood morbid mortdecai motown mr tea my chemical romance my sharona naked juice ncis ncisla nerd nerdist new eagle cafe new politics new scene nickleback nightmare before christmas nijiya nimitz noisey nonfiction novo biocin ofelia only in youth osaka loop line ovid pai gow pam pancakes pandemic paranormal activity part time job party past present felix patreon patrick kindlon pcr pe'ahi peanut butter and jelly peb pecan tree penny dreadful performance peter pan collar pfam photog physics pita pizza plants plastic metal platelets poker pole polefiction politics popo popoitis post office potpourri pow wow hawaii primer prince procrastination protein pu er pun punk pyogenes pyromaniac quiche r dorothy wayneright rage ramblings ramen random random weirdos rap record shop dude records red machine redbone reflective replacements revision rhcp rick and morty ripd roller skates rooms of the house roxy rozwell kid rsd run for cover run the jewels sailor moon sakura mochi salem's lot salonpas samurai ice cake sapling scans scary scorpion sds page searching for a pulse sed rate seeking a friend for the end of the world self defense family self published separation sequins seven psychopaths shadowplay shaloha sheezus shimmering stars shoes shout out louds show sierra nevada sikdorak silly girl sinclair library skateboard skyfall slipshift small brown bike smart db smoke gets in your eyes snl somnio sorority noise soundcloud speech and debate sphere spyral stamps staph staphylococci star trek static trap steam stellastarr* straddle ups string db suetonius suicide squad suis la lune sunday morning at a funeral sunny day real estate surya namaskar sushi sushi king swim swoon taco tuesday tantalus target taste tea taunt tcb technical writing tempura tf2 tguk thanksgiving the angels the audition the bougies the calm blue sea the chase the get up kids the hives the killers the kingsmen the kinks the pipettes the quick the raconteurs the russian the saddest landscape the supremes the things we think we're missing the voices the weight of the world the wolfpack the xx there's nothing thieves like us threadless three cheers for sweet revenge thursday ticket to ride tideland tigers jaw time travel tiny me tittibhasana toby tokyo milk tom moffat topshelf records totoro tour de france transfection transformation tricks trojans tron tv two dots udon uniprot unknowns unrelatableexperience vacation valve vampire vegetables verde verse vertigo vibrio vice video dump volary walking backwards man walmart want to read war wednesday addams welwing what we do in the shadows white house down white stripes whole foods wildhoney wildlife wired won tons wu xia xbox 360 yoga ball yogagypsy zatanna zero zippys zombie zones